21. A very short eukaryotic mRNA has the sequence… 5′ ACGCCGAUCAUGGGCAUGCGAGUAUAAAAACUGG 3 ‘ How many amino acids are encoded by this message? | Cheap Nursing Papers
0

21. A very short eukaryotic mRNA has the sequence… 5′ ACGCCGAUCAUGGGCAUGCGAGUAUAAAAACUGG 3 ‘ How many amino acids are encoded by this message?

at
Categories
Tags

21. A very short eukaryotic mRNA has the sequence…

5′ ACGCCGAUCAUGGGCAUGCGAGUAUAAAAACUGG 3 ‘

How many amino acids are encoded by this message?

a. 11

b. none

c.4

d.7

e.5

I know the answer is 5, e. But I don’t know how to tell how this is, I looked at the codon chart but I’m not sure how it’s 5 and not 13?

"Get 15% discount on your first 3 orders with us"
Use the following coupon
FIRST15

Order Now

Related posts

November 26, 2023

a running track measures 1056 ft per lap. to run 15.0 km how many laps should you run? How do you break the equation down into a solution map?

Read more
November 26, 2023

A local magic shop has a monopoly on the production of magic wands. Each customer wants only one magic wand, and the table below shows each…

Read more
November 26, 2023

A machine produces pipes used in airplanes. The average length of the pipe is 16 inches. The acceptable variance for the length is .3 inches. A…

Read more

Hi there! Click one of our representatives below and we will get back to you as soon as possible.

Chat with us on WhatsApp